View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_high_40 (Length: 284)
Name: NF4850_high_40
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 29271146 - 29271396
Alignment:
| Q |
18 |
ccttctccaatctccccacactcctccactctccgccaaaagctttgtccccgccgccgcgccgatcaccggcgtgttgaaaattgattacttatcaccg |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29271146 |
ccttctccaatctccccacactcc---actctccgccaaaagctttgtccccgccgccgcgccgatcaccggcgtgttgaaaattgaatacttatcaccg |
29271242 |
T |
 |
| Q |
118 |
ccatctcttcaccatccctaatatctcagtgatgc-nnnnnnnnnnnnnnncaatgaaatgaatcattattattatttctgaaaacttcgatttttctgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29271243 |
ccatctcttcaccatccctaatatctcagtgatgcaaaaaaaaaaaaataacaatgaaatgaatcattattattatttctgaaaacttcg-tttttctgt |
29271341 |
T |
 |
| Q |
217 |
caacaatgctacgaatgaagttgttttccgacaaccttacctcaatccctcagaa |
271 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29271342 |
cgacaatgctacgaatgaagttgttttccgacaaccttacctcaatccctcagaa |
29271396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University