View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4850_high_61 (Length: 231)

Name: NF4850_high_61
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4850_high_61
NF4850_high_61
[»] chr4 (1 HSPs)
chr4 (1-213)||(24065748-24065960)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 24065960 - 24065748
Alignment:
1 actatagaactattctaatctagaagggttgatatttggacgtggaaaatttgttcttctgaatttgattgatgggaatgaatttgggatggattcatga 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24065960 actatggaactattctaatctagaagggttgatatttggacgtggaaaatttgttcttctgaatttgattgatgggaatgaatttgggatggattcatga 24065861  T
101 aacccctttggggacaaatatctggtatggttctaaaatggacaatcacttattaaaataatacactgtattgtgtagaccaatgttagctggttctcat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24065860 aacccctttggggacaaatatctggtatggttctaaaatggacaatcacttattaaaataatacactgtattgtgtagaccaatgttagctggttctcat 24065761  T
201 gtgatggattgtg 213  Q
    |||||||||||||    
24065760 gtgatggattgtg 24065748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University