View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_13 (Length: 498)
Name: NF4850_low_13
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 289 - 329
Target Start/End: Complemental strand, 23621358 - 23621318
Alignment:
| Q |
289 |
atatttgggaggaacacttaagatcgagtaatattatattt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23621358 |
atatttgggaggaacacttaagatcgagtaatattatattt |
23621318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University