View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_17 (Length: 470)
Name: NF4850_low_17
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 2e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 15 - 173
Target Start/End: Complemental strand, 29673109 - 29672951
Alignment:
| Q |
15 |
tcatcaaacacatggattaacaccaaacttggttcatcatcttcatactcttctcctttcaaagattcaagatcaaattcaatcactttaaagaagaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29673109 |
tcatcaaacacatggattaacaccaaacttggttcatcatcttcatactcttctcctttcaaagattcaagatcaaattcaatcactttaaagaagaaaa |
29673010 |
T |
 |
| Q |
115 |
gatctatctcccaaaacaacaaaatctcatgctcacttcaaacaacactaccttttcct |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29673009 |
gatctatctcccaaaacaacaaaatctcatgctcacttcaaacaacactaccttttcct |
29672951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 309 - 448
Target Start/End: Complemental strand, 29672815 - 29672676
Alignment:
| Q |
309 |
gccgccaccgcccttgacttcgtcgaaacaaccttaatcaaacaagaacagaaacacccactaccaaaaacctccgacccacgtgtccaaattgccggta |
408 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
29672815 |
gccgccaccgccctcgacttcgtcgaaacaaccttaatcaaacaagaacaaaaacacccactacccaaaacctccgacccacgtgttcaaattgccggta |
29672716 |
T |
 |
| Q |
409 |
acttcgccccagtaccggaacacccggtaacccaatctct |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672715 |
acttcgccccagtaccggaacacccggtaacccaatctct |
29672676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University