View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_20 (Length: 401)
Name: NF4850_low_20
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 18 - 166
Target Start/End: Original strand, 36011572 - 36011720
Alignment:
| Q |
18 |
atccgaagccgcaaaagttgctattccaaatatgaaattcctattatgatcacacattaatttgtcaatattttaaaaatcgatttgaagatcaaattga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36011572 |
atccgaagccgcaaaagttgctattccaaatatgaaattcctattatgatcacacattaatttgtcaatattttaaaaatcgatttgaagatcaaattga |
36011671 |
T |
 |
| Q |
118 |
tgatactttcatgattcaattggtttaaaccatgctcgaaccggatgct |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36011672 |
tgatactttcatgattcaattggtttaaaccatgctcgaaccggatgct |
36011720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 223 - 375
Target Start/End: Original strand, 36011779 - 36011932
Alignment:
| Q |
223 |
gaatcggttgaaatgc-ggttcaacccgattttgatggattgagaatcgaatgtggttgaaaacaatgacaaacttattgattccgaactcaatcggttt |
321 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36011779 |
gaatcggttgaactgctggttcaacccgattttgatggattgagaatcgaatgtggttgaaaacaatgacaaacttactgattccgaactcaatcggttt |
36011878 |
T |
 |
| Q |
322 |
gttcggtttgattatgaaaacactattatttacttcctccgtcccattttaagt |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36011879 |
gttcggtttgattatgaaaacactattatttacttcctccgtcccattttaagt |
36011932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University