View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_28 (Length: 343)
Name: NF4850_low_28
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 20 - 338
Target Start/End: Complemental strand, 48922824 - 48922506
Alignment:
| Q |
20 |
gctctttatgcagcatatacaaaaaataagaagttgcagattaactgcagcacatgttgttaactcatcttagtttagcacttgaacatgtatatatttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48922824 |
gctctttatgcagcatatacaaaaaataagaagttgcagattaactgcagcacatgttgttaactcatcttagtttagcacttgaacatgtatatatttg |
48922725 |
T |
|
| Q |
120 |
ttcaccaataatctaatcattatcaatgtaaacttcgttaattagtgtccattatatatgaaatgcttatctagaaatcccttttgcatttattatctct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48922724 |
ttcaccaataatctaatcattatcaatgtaaacttcgttaattagtgtccattatatatgaaatgcttatctagaaatcccttctgcatttattatctct |
48922625 |
T |
|
| Q |
220 |
ttccttatacaactctgataaacttgtaggattctatctcaagatttttgttacatgaaacaaagctcctgctttgtagtttgtatgacgcttcatgaaa |
319 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48922624 |
ttccttttacaactctgataaacttgtaggattctatctcaagatttttgttacatgaaacaaagctcctgctttgtagtttgtatgacgcttcatggaa |
48922525 |
T |
|
| Q |
320 |
ggatcgaattcatctcact |
338 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
48922524 |
ggatcgaattcacctcact |
48922506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 79 - 118
Target Start/End: Original strand, 48876383 - 48876422
Alignment:
| Q |
79 |
ttaactcatcttagtttagcacttgaacatgtatatattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
48876383 |
ttaactcatcttagtttagcacttgaacatgcatgtattt |
48876422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University