View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_29 (Length: 332)
Name: NF4850_low_29
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 23 - 314
Target Start/End: Complemental strand, 71628 - 71337
Alignment:
| Q |
23 |
caagaacctagtaattccacataaaactctcgaaactagttacaacaccattattaacaagtccatcatcaccaacacaacaaccatcttcttcttgtgt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
71628 |
caagaacctagtaattccacataaaactctcgaaactagttacaacaccattattaacaagtccatcatcaccaacacaacaaccatcttcttcttgtgt |
71529 |
T |
 |
| Q |
123 |
tgtttgtagccatgtcattggttgctgatacatcatccaagcatagtcttgtgcttgtgagtcaacatagacaaattcctctttcccaacatcatcataa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
71528 |
tgtttgtagccatgtcattggttgctgatacatcatccaagcatagtcttgtgcttgtgagtcaacatagacaaattcctctttcccaacatcatcataa |
71429 |
T |
 |
| Q |
223 |
ccgttttccaaagttggtagctcaataatctcactaagttcttcagaagtagctgacaagtctgctgatgaagacagagttttcgttgtctt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
71428 |
ccgttttccaaagttggtagctcaataatctcactaagttcttcagaagtagctgacaagtctgctgatgaagacagagtttttgttgtctt |
71337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University