View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_30 (Length: 330)
Name: NF4850_low_30
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 34934865 - 34934554
Alignment:
| Q |
1 |
actatagggtggaaatattcctttgcaggtgtcaagctttgtaggtggtggtggtggtgttgctacgtcatagtcgtcaaattgtccatgacaaatttcc |
100 |
Q |
| |
|
|||||||| | |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34934865 |
actataggttagaaatattccgttgcaggtgtcaagacccttaggtggtggtggtggtgttgctacgtcatagtcgtcaaattgtccatgacaaatttcc |
34934766 |
T |
 |
| Q |
101 |
aaacccgaaaacacaaatacacacgacaacaacaataataaaagtgtttggtaagaggaagttttaccttccttaaaaaatttcattcttgtcttgttac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34934765 |
aaacccgaaaacacaaatacacacgacaacaacaataataaaagtgtttggtaagaggaagttttaccttccttaaaaaatttcattcttgtcttgttac |
34934666 |
T |
 |
| Q |
201 |
cttggaaacaacaatcaatattgtttttatttatttaatctttctatagnnnnnnnggttttgtgtgtgtaaagaggatgatgataattaagaaggtcgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34934665 |
cttggaaacaacaatcaatattgtttttatttatttaatctttctatagtttttttggttttgtgtgtgtaaagaggatgatgatagttaagaaggtcgg |
34934566 |
T |
 |
| Q |
301 |
ccgcggtaatac |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34934565 |
ccgcggtaatac |
34934554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University