View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_44 (Length: 275)
Name: NF4850_low_44
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 19 - 270
Target Start/End: Complemental strand, 28744212 - 28743951
Alignment:
| Q |
19 |
atccgtcatgagaatcttgaatttggggatgacaatcccgaaaatacacaattgtgctgcatttgtctggtaattaggtt---------------aactt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
28744212 |
atccgtcatgagaatcttgaatttggggatgacaatcccgaaaatacacaatcgtgctgcatttgtctggtaattaggttttttaacattaggttaactt |
28744113 |
T |
 |
| Q |
104 |
aacgaatggatgtcacttcaattcattttcaattatatttatatcgcgctctatatacactctttggttagatcgaaagactatgcatgtattttctaac |
203 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28744112 |
aacgaatgcatgtcacttcaattcattttcaatt-----tatatcgcgctctatatacactctttcgttagatcgaaagactatgcatgtattttctaac |
28744018 |
T |
 |
| Q |
204 |
aaatttgatgtaataccaggaaaattttgatgctggtgaagaaattgaaagactggactgtgcacat |
270 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28744017 |
aaatttgatgtaatatcaggaaaattttgatgctggtgaagaaattgaaagactggactgtgcacat |
28743951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University