View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_45 (Length: 274)
Name: NF4850_low_45
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 40265791 - 40266040
Alignment:
| Q |
11 |
cacagagaccgaagcagacaatggagctgacactcccacctttacaccttggagatgattcaatgttttacatgcacgtgcccaacccgaatcttcaaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40265791 |
cacagagaccgaagcagacaatggagctgacactcccacctttacaccttggagatgattcaatgttttacatgcacgtgcccaacccgaatcttcaaac |
40265890 |
T |
|
| Q |
111 |
gtctcgcttccaaccacaagcacgcgaccggtcccatcatcct----aacagaattgaaggacttgttatctaaaatattaatttcaagtatattctgtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40265891 |
gtctcgcttccaaccacaagcacgcgaccggtcccatcatcctaacaaacagaatataaggacttgttatctaaaatattaatttcaagtatattctgtt |
40265990 |
T |
|
| Q |
207 |
aaaatgtttagtttataagcttaaatattcacttcaagaaacaggcatct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40265991 |
aaaatgtttagtttataagcttaaatattcacttcaagaaacaggcatct |
40266040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 119 - 155
Target Start/End: Original strand, 40284660 - 40284696
Alignment:
| Q |
119 |
tccaaccacaagcacgcgaccggtcccatcatcctaa |
155 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
40284660 |
tccaaccacaagcacacgaccagtcccatcatcctaa |
40284696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University