View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_52 (Length: 252)
Name: NF4850_low_52
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_52 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 252
Target Start/End: Complemental strand, 45305820 - 45305579
Alignment:
| Q |
7 |
tccaagaatattataccattctctctccctctcttgcaattcatgtgacctagaagaagagttcattctattcagtcatcaatctcc--ctcctcaacta |
104 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45305820 |
tccaacaatattataccattctctctc------ttgcaattcatgtgacctagaagaagagttcattctattcagtcatcaatctccatctcctcaacta |
45305727 |
T |
|
| Q |
105 |
attaacaatggttatggtttttgttattaccatctcatagcagcatcaatcaacctatatatgccatatatatgcacccttttcatttcaactagctagc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45305726 |
attaacaatggttatggtttttgttattaccatctcatagcagcatcaatcaacctatatatgccatatatatgcacccttttcatttcaactagctagc |
45305627 |
T |
|
| Q |
205 |
taggtcttgccatttttattttggtcattgccactcacttcttttccc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45305626 |
taggtcttgccatttttattttggtcattgccactcacttcttttccc |
45305579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University