View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_55 (Length: 249)
Name: NF4850_low_55
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_55 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 44845945 - 44846185
Alignment:
| Q |
9 |
ttatactacatcgtttaggaaatattgaattttgacttgggttaaaatacctcatccaatctttactttttgtatggtcagtataaatattttacagtaa |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44845945 |
ttatactacatagtttaggaaatattgaattttgacttgggttaaaatacctcatccaatctttactttttgtatggtcagtataaatattttactgtaa |
44846044 |
T |
 |
| Q |
109 |
cctaatcataagttgagtatctctctctggtcactgatgtatctcccaaatgtttcctcctctcctaggtggaaacacttcaacttgcatcagtataagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44846045 |
cctaatcataagttgagtatctctctctggtcactgatgtatctcccaaatgtttcctcctctcctaggtggaaacacttcaacttgcatcagtataagt |
44846144 |
T |
 |
| Q |
209 |
tgtagaacagttaaaggaatgtagcaacataggtgcccatt |
249 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44846145 |
tgtagaacagttaaaagaatgtagcaacataggtgcccatt |
44846185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University