View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_59 (Length: 237)
Name: NF4850_low_59
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 4 - 219
Target Start/End: Complemental strand, 35508621 - 35508405
Alignment:
| Q |
4 |
gcgtctccctcatcgctatcacttccattctgataaacacnnnnnnnn-ttgtaacacaagcacggaaaccttattaatagtacttcaagagtacataaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35508621 |
gcgtctccctcatcgctatcacttccattctgataaacacaaaaaaaaattgtaacacaagcacgcaaaccttattaatagtacttcaagagtacataaa |
35508522 |
T |
 |
| Q |
103 |
aaataatgtattgctagcatttctcaccgcactattaatctccacttcaactgtagaatctggcgattcctttcccgatgattcttcttctgatgattca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508521 |
aaataatgtattgctagcatttctcaccgcactattaatctccacttcaactgtagaatctggcgattcctttcccgatgattcttcttctgatgattca |
35508422 |
T |
 |
| Q |
203 |
ctaattccatctagagc |
219 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35508421 |
ctaattccatctagagc |
35508405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University