View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_64 (Length: 227)
Name: NF4850_low_64
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_64 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 18871346 - 18871124
Alignment:
| Q |
6 |
agtagttaggtccctgtatttaaaatacataaataatgtgtgaaatcacatgaacaagaagaatcattttgcatttgcaaagtttggattagcttctgat |
105 |
Q |
| |
|
||||||| |||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18871346 |
agtagtttggtccctgtatttaaaatccatcaataatgtatgaaatcacatgaacaagaagaatcattttgcatttgcaaagtttggattagcttctgat |
18871247 |
T |
|
| Q |
106 |
t-ataagaggcagttaattgcgataactatttgataactagttgtgaaacaactattatcacagaaatgtgcaatcccctttctgaattatcagactcaa |
204 |
Q |
| |
|
| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18871246 |
ttataagagccagttaattgaaataactatttgataactagttgtgaaacaactattatcacagaattgtgcaatcccctttctgaattatcagactcaa |
18871147 |
T |
|
| Q |
205 |
gtcaatcaataacgccataacta |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
18871146 |
gtcaatcaataacgccataacta |
18871124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University