View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4850_low_66 (Length: 202)
Name: NF4850_low_66
Description: NF4850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4850_low_66 |
 |  |
|
| [»] scaffold0657 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0657 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: scaffold0657
Description:
Target: scaffold0657; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 14 - 175
Target Start/End: Original strand, 7176 - 7337
Alignment:
| Q |
14 |
ataattcttccaaaattcaatctaaaaactttagcataaaa-taatagatactttgacatagataacaaactagaaaattcgacacattttaaaacgata |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7176 |
ataattcttccaaaattcaatctaaaa-cttcagcataaaaataatagatactttgacatagataacaaactagaaaattcgacacattttaaaacgata |
7274 |
T |
 |
| Q |
113 |
aataggaagagcaacaacaacaattatctagcaagggcaacaaatttcgccgcaaaagcaaca |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
7275 |
aataggaagagcaacaacaacaattatccaccaagggcaacaaatttcgccgcaaaagcaaca |
7337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University