View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4851-Insertion-4 (Length: 193)
Name: NF4851-Insertion-4
Description: NF4851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4851-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 7 - 190
Target Start/End: Complemental strand, 47651263 - 47651080
Alignment:
| Q |
7 |
aatttgtccgtttaatgttttgtggtgactgtggtttggttatgtctgggggttctggccttgggtctttagctctctagcagtttggtgcaggttttta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47651263 |
aatttgtccgtttaatgttttgtggtgactgtggtttggttatgtctgggggttctggccttgggtctttagctctctagcagtttggtgcaggttttta |
47651164 |
T |
|
| Q |
107 |
ctggtgtcgcaatatcaaagttagtgtaatgttcggtttaagtatctctatgtgtcggtgcttcgtagacaagttgtgctgata |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47651163 |
ctggtgtcgcaatatcaaagttagtgtaatgttcggtttaagtatctctatgtgtcggtgcttcgtagacaagttgtgctgata |
47651080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University