View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4851-Insertion-5 (Length: 239)
Name: NF4851-Insertion-5
Description: NF4851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4851-Insertion-5 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 185 - 239
Target Start/End: Original strand, 4409432 - 4409486
Alignment:
| Q |
185 |
ctacactatagtttgcagtttgcactcttcaatgcttttgttattcttgaggtga |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409432 |
ctacactatagtttgcagtttgcactcttcaatgcttttgttattcttgaggtga |
4409486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 106 - 145
Target Start/End: Original strand, 4409349 - 4409388
Alignment:
| Q |
106 |
atctttgcatttacatacataggtgcataaactagccccc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409349 |
atctttgcatttacatacataggtgcataaactagccccc |
4409388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 37
Target Start/End: Original strand, 4409249 - 4409280
Alignment:
| Q |
6 |
cactgcaccaaacactatacactgtatcaatg |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4409249 |
cactgcaccaaacactatacactgtatcaatg |
4409280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University