View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4853-Insertion-7 (Length: 275)
Name: NF4853-Insertion-7
Description: NF4853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4853-Insertion-7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 275
Target Start/End: Original strand, 17945681 - 17945948
Alignment:
| Q |
8 |
tctttttcatccaatttatgtgctacagaagtttgacttattttttcggtttctttcttagctacattatcaattgatattcgagttcgaaaagattgac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17945681 |
tctttttcatccaatttatgtgctacagaagtttgactgattttttcggtttctttcttagctacattatcaattgatatatgagttcgaaaagattgac |
17945780 |
T |
 |
| Q |
108 |
ttgctttaccagtccatacaagaatcccaaaatgatcgtttggtttcgccatttcttcttcagttggtttgtcagttaatatgtgagttccaaaaggttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17945781 |
ttgctttaccagtccatacaagaatcccaaaatgatcgtttggttttgccatttcttcttcagttggtttgtcaattaatatgtgagttccaaaaggttg |
17945880 |
T |
 |
| Q |
208 |
ttttggttttgcactttctttttgttcccaccatatgttaattccaaaaggttgtcttgcttttgcac |
275 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17945881 |
ttttggttttacactttctttttgttcccaccatatgttaattccaaaaggttgtcttgcttttgcac |
17945948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University