View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4853_low_4 (Length: 387)
Name: NF4853_low_4
Description: NF4853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4853_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 241 - 370
Target Start/End: Complemental strand, 40208594 - 40208465
Alignment:
| Q |
241 |
gttggtgggcctaaatcgagggttatagtagccttatccttaggatgtgcatgtttttaatattttttacaattatcgttacaacttacaaataggatcg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208594 |
gttggtgggcctaaatcgagggttatagtaaccttatccttaggatgtgcatgtttttaatcttttttacaattatcgttacaacttacaaataggatcg |
40208495 |
T |
|
| Q |
341 |
acacaaaaagtcatagtgtctcaccgtgat |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40208494 |
acacaaaaagtcatagtgtctcaccgtgat |
40208465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 19 - 169
Target Start/End: Complemental strand, 40208818 - 40208667
Alignment:
| Q |
19 |
caacatccccctatacaacaaatgatgtggnnnnnnnggtaaaaattgagaccacttacaacagacggtccaataatttttaatagtaagtaagat--ga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| || |
|
|
| T |
40208818 |
caacatccccctatacaacaaatgatgtggtttttttggtaaaaattgagaccacttacaag-gacggtccaataatttttaatagtaagtgagatatga |
40208720 |
T |
|
| Q |
117 |
gacaaattttattatatgtggccttttttgtatgctgatgaggttattttgtc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40208719 |
gacaaattttattatatgtggccttttttgtctgctgatgaggttattttgtc |
40208667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University