View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854-Insertion-16 (Length: 323)
Name: NF4854-Insertion-16
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854-Insertion-16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 33 - 320
Target Start/End: Complemental strand, 4050636 - 4050351
Alignment:
| Q |
33 |
tcctctcgcagctataccccacgccgtcacacaacaggtagcagcatacttcccacaagactttaaactgatggtgatgtcaatttaatcatcaaccatc |
132 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4050636 |
tcctctcgcagctataccccatgcc-tcacacaacaggtagcagcacacttcccagaagactttaaactgatggtgatgtcaatttaatcatcaaccatc |
4050538 |
T |
 |
| Q |
133 |
ttactatttgcccttccctccaactacatttgttgtctcacaatttttcatcttttacctcttttaccacaatttttaatcataacctcttcaactccaa |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
4050537 |
ttactatttgcccttccctccaactacatttgttgtctcacaatttttcctcttttacctcttttaccacaagtttttatcataacttcttcaactccaa |
4050438 |
T |
 |
| Q |
233 |
agtgtgcttacgcgtcctcttaaagattcccttgctctcacataaatcataacacccaaggacttcttagttgtacaactttgatgcc |
320 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4050437 |
agtgtgcttatgcgt-ctcttaaagattcccttgctctcacataaatcataacacccaaggacttcatagttgtacaactttgatgcc |
4050351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University