View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854-Insertion-20 (Length: 197)
Name: NF4854-Insertion-20
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854-Insertion-20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 5023840 - 5023750
Alignment:
| Q |
12 |
ctccggtgattaaggagacaagaaaacaatggggtgattttataggtactccctttctgaatcaattatatgaggagcatctcagtgagaa |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
5023840 |
ctccagtgattaaggagacaagaaaacaatggggtgattttataggtactccctttctaaatcaattatatgaggagcatcttagtgagaa |
5023750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 5019567 - 5019518
Alignment:
| Q |
148 |
gtggcaatggtgcgtgatgactttcttgctctttcaagtctgttatacta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
5019567 |
gtggcaatggtgcgtgatgactttcttgctctttcaagtcggctatacta |
5019518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University