View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854-Insertion-22 (Length: 107)
Name: NF4854-Insertion-22
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854-Insertion-22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 6 - 107
Target Start/End: Complemental strand, 5714324 - 5714223
Alignment:
| Q |
6 |
cagggatatgaaactcactaactgtcatgctttctgatggctaggttcagccatgaaattcaatattcatactctaatattacacataattcaatatttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714324 |
cagggatatgaaactcactaactgtcatgctttctgatggctaggttcagccatgaaattcaatattcatactctaatattacacataattcaatatttt |
5714225 |
T |
|
| Q |
106 |
ga |
107 |
Q |
| |
|
|| |
|
|
| T |
5714224 |
ga |
5714223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University