View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854-Insertion-7 (Length: 103)
Name: NF4854-Insertion-7
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854-Insertion-7 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 1e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 8 - 103
Target Start/End: Complemental strand, 23235275 - 23235180
Alignment:
| Q |
8 |
aattcaaccctagattattaaaaccagccctgacgtcacaatatcagatccttagaacataacttatacataaattataatccaacacactttcag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23235275 |
aattcaaccctagattattaaaaccagccctgacgtcacaatatcagatccttagaacataacttatacataaattataatccaacacactttcag |
23235180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 23239934 - 23239883
Alignment:
| Q |
17 |
ctagattattaaaaccagccctgacgtcacaatatcagatccttagaacata |
68 |
Q |
| |
|
||||||||||||||||| || ||| |||||||||||| ||||||| |||||| |
|
|
| T |
23239934 |
ctagattattaaaaccatccttgatgtcacaatatcaaatccttacaacata |
23239883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.000000000000008
Query Start/End: Original strand, 19 - 91
Target Start/End: Original strand, 23122548 - 23122620
Alignment:
| Q |
19 |
agattattaaaaccagccctgacgtcacaatatcagatccttagaacataacttatacataaattataatcca |
91 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
23122548 |
agattattaaaaccagccttgatatcacaatatgagatccttacaacataatttatacataaacaataatcca |
23122620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University