View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_high_19 (Length: 282)
Name: NF4854_high_19
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 37 - 266
Target Start/End: Original strand, 45886413 - 45886640
Alignment:
| Q |
37 |
gttgtcgcggcttcaattgttttcacgttgccatttcaacaacattaaaagaaaaaacctttattgtcagcttgtatcattacaatgtgcctttaactaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45886413 |
gttgtcgcggcttcaattgttttcacgttgccatttcaacaa--ttaaaagaaaaaacctttattgtcggcttgtatcattacaatgtgcctttaactaa |
45886510 |
T |
 |
| Q |
137 |
aattatgctaccttaaaatattctttttggatcattgtttcatagaattgttttattttgacacataatgttgtcatcaaaattcgacaacttaaatggt |
236 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45886511 |
aattatgataccttaaaatattctttttggatcattgtttcatagaactgttttattttgaaacataatgttgtcatcaaaattcgacaacttaaatggt |
45886610 |
T |
 |
| Q |
237 |
gaatacaatataaaatgcgattaactatgt |
266 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |
|
|
| T |
45886611 |
gaatacaataaaaaatgcgattaactatgt |
45886640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 36
Target Start/End: Original strand, 895732 - 895762
Alignment:
| Q |
6 |
gtagataattctcatgactaattatacaaca |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
895732 |
gtagataattctcatgactaattatacaaca |
895762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University