View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_high_20 (Length: 255)
Name: NF4854_high_20
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 234
Target Start/End: Original strand, 6948155 - 6948380
Alignment:
| Q |
11 |
cataggaatataatatttaccccgtaactataaaatcaagatagttagatcgtattgctacgagtgaaacaacatcaacaatactcaattctgaattgag |
110 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6948155 |
cataggaatataatatttaccccttaactataaaatcaagatagttagatcgtattgctacgagtgaaacaacatcaacaatactcaattctgaattgag |
6948254 |
T |
 |
| Q |
111 |
gggttgcnnnnnnnn--tgtgttataggttggaatgtgctacctgtgggaaatatacatggggaggatgtggtaaacacttgaccaccctctacagaagt |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6948255 |
gggttgcaaaaaaaaaatgtgttataggttggaatgtgctacctgtgggaaatatacatggggaggatgtggtaaacacttgaccaccctctacagaagt |
6948354 |
T |
 |
| Q |
209 |
attgatgaaggaatgcactgtatgtg |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6948355 |
attgatgaaggaatgcactgtatgtg |
6948380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University