View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_high_21 (Length: 250)
Name: NF4854_high_21
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 6 - 234
Target Start/End: Original strand, 41723426 - 41723654
Alignment:
| Q |
6 |
agaagcaaaggcgaaaaaagctgaaaaagatgcagaagaattgagagaatcttctaaacgtgaaggtcaagaacattcttctgatctcaggaaacacaaa |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41723426 |
agaagaaaaggcgaaaaaagctgaaaaagatgcagaagaattgagagaatcttctaaacgtgaaggtcaagaacattcttctgatctcaggaaacacaaa |
41723525 |
T |
|
| Q |
106 |
actgctttcattgagttggtttcaaatcaaagacaccttgaagctgaactcggtcgcgctgttaagcatttggatgctacaaaagaggaacttattgctg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41723526 |
actgctttcattgagttggtttcaaatcaaagacaccttgaagctgaactcggtcgcgctgttaagcatttggatgctgcaaaagaggaacttattgctg |
41723625 |
T |
|
| Q |
206 |
tcatggagaacaaagaggagtctgatttg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41723626 |
tcatggagaacaaagaggagtctgatttg |
41723654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University