View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_high_29 (Length: 227)
Name: NF4854_high_29
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_high_29 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 41020507 - 41020287
Alignment:
| Q |
7 |
ccttctggtttcaatgtcgtggcacggagtcaacaaggcgcagtcgctgccatccagaatccctccgccaaattctatggccttcagtatcaccccgagg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41020507 |
ccttctggtttcaatgtcgtggcacggagtcaacaaggcgcagtcgctgccatccagaatccctccgccaaattctatggccttcagtatcaccccgagg |
41020408 |
T |
|
| Q |
107 |
tatatataaatagacatagttaaaaccaatgtctaatttctcaatcttaatttttaaattaatctattgatatttcaattgaatttacttgtttgtgttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41020407 |
tatatataaatagacatagttaaaaccaatgtctaatttctcaatcttaa-ttttaaattaatctattgatatttcaattgaatttccttgtttgtgttt |
41020309 |
T |
|
| Q |
207 |
aattttgattct-atacactct |
227 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
41020308 |
aattttgattctgatacactct |
41020287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University