View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_low_12 (Length: 333)
Name: NF4854_low_12
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 11 - 318
Target Start/End: Complemental strand, 37307701 - 37307394
Alignment:
| Q |
11 |
cagagacaaccccaattgcaaacgtctcaacaaatccaggcttagtatcaagcttcatgtcaagtatagcaagtctttggttaaccgaatccatctttct |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37307701 |
cagaaacaaccccaattgcaaacgtctcaacaaatccaggcttagtatcaagcttcatgtcaagtatagcaagtctttggttaaccgaatccatctttct |
37307602 |
T |
 |
| Q |
111 |
agaagattcattcataagcctatcctttttacctttaccagatgaaattactccaaacaaagccttttgtaaatcctctatcaccttcaatgaggcttct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37307601 |
agaagattcattcataagcctatcctttttacctttaccagatgaaattactccaaacaaagccttttgtaaatcctctatcaccttcaatgaggcttct |
37307502 |
T |
 |
| Q |
211 |
tgtgaatccatcccttgtgattcataataggatatcaattcctttggtgaaggaatcttctttttcggatttggtttcattttgatttcagatatagaag |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37307501 |
tgtgaatccatcccttgtgattcataataggatatcaattcctttggtgaaggaatcttctttttcggatttggtttcattttgatttcaggtatagaag |
37307402 |
T |
 |
| Q |
311 |
gtacattt |
318 |
Q |
| |
|
|||||||| |
|
|
| T |
37307401 |
gtacattt |
37307394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University