View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_low_14 (Length: 320)
Name: NF4854_low_14
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 33645095 - 33645395
Alignment:
| Q |
1 |
gtaagcattgcgtgatcatgagtatcctctaaatccttttgataatatgtgcaggccaaggaaatggaatgtatgtgtgataggttcccatgaccttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33645095 |
gtaagcattgcgtgatcatgagtatcctctaaatccttttgataatatgtgcaggccaaggaaatggaatgtatgtgtgataggttcccatgatcttttc |
33645194 |
T |
 |
| Q |
101 |
gagcatccgcatattaatgatcttgcttacatgcctgctaataaggatggtcgatttggattcaacttattggtgggtggtttctttagtcccaagcgat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33645195 |
gagcatccacatattaatgatcttgcttacatgcctgctaataaggatggtcgattcggattcaacttattggtgggtggtttctttagtcccaagcgat |
33645294 |
T |
 |
| Q |
201 |
gtgctgaagcagttccacttgatgcttgggtctctgcagatgatgttatcccactttgtaaagctgtccttgagacctatagagacctcggcaccagagg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33645295 |
gtgctgaagcagttccacttgatgcttgggtctctgcagatgatgttatcccactttgtaaagctgttcttgagacctatagagacctcggcaccagagg |
33645394 |
T |
 |
| Q |
301 |
c |
301 |
Q |
| |
|
| |
|
|
| T |
33645395 |
c |
33645395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University