View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_low_20 (Length: 275)
Name: NF4854_low_20
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 37122948 - 37123167
Alignment:
| Q |
19 |
agctcacacatttctaaaggtagagaaatagggtatttaagatttgaatctcagccacaacatatattatgcaatatcactcaattaagcttagtgaacc |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37122948 |
agctcacacatttctaaagatagagaaatagggtatttaagatttgaatctcagcaacaacatatattatgcaatatcactcagttaagcttagtgaacc |
37123047 |
T |
|
| Q |
119 |
taatttaattgctgagaaaaaatattcttaaataaacgtttagaa-ttttannnnnnnnaaggaattccacatttggaattatcaactcatgtttgccaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37123048 |
taatttaattgctgagaaaaaatattcttaaataaacgtttagaatttttatttttttaaaggaattcaacatttggaattatcaactcatgtttgccaa |
37123147 |
T |
|
| Q |
218 |
acaaagactaatcaactcat |
237 |
Q |
| |
|
||||||| | |||||||||| |
|
|
| T |
37123148 |
acaaagaattatcaactcat |
37123167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 37112689 - 37112721
Alignment:
| Q |
117 |
cctaatttaattgctgagaaaaaatattcttaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
37112689 |
cctaatttaattgctgagaaaaaatatttttaa |
37112721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University