View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_low_23 (Length: 244)
Name: NF4854_low_23
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 13 - 175
Target Start/End: Original strand, 32315038 - 32315197
Alignment:
| Q |
13 |
aaaatccacaaaatcagtacgttagattcctttttcatcacgaactactacaaactctgaattgaacatgtgagtgagtttgttaaacccacgtcaagtg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32315038 |
aaaatccacaaaatcagtacgttagattcctttttcatcacgaacta---caaactctgaattgaacatgtgagtgagtttgttaaacccacgtcaagtg |
32315134 |
T |
 |
| Q |
113 |
tccaaacaaatttaactctatcgcattagttgagcaaaatttccaaccaagggtgtcaaatca |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32315135 |
tccaaacaaatttaactctatcgcattagttgagcaaaatttccaaccaagggtgtcaaatca |
32315197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University