View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_low_25 (Length: 240)
Name: NF4854_low_25
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 29168325 - 29168120
Alignment:
| Q |
20 |
ccatgtagttgcctgtctcttgcaagtgtgatgaggaaatattgagagtaataataatgcagttgaacaagctgcatgcaatgatgaagatatctttgtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29168325 |
ccatgtagttgcctgtctcttgcaagtgtgataaagaaatattgagagtaataat---gcagttgaacaagctgcatgcaatgatgaagatatctttgtt |
29168229 |
T |
 |
| Q |
120 |
gcttttcttaggcttcattgcaactatggttgatgctcgtttggatccaagtccaacaagcgtcaatggtgttcatttcaaattgttaaacgaagtgtgc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29168228 |
gcttttcttaggcttcattgcaactatggttgatgctcgtttggatccaagtccaacaaccctcaatggtgttgatttcaaattgttaaacgaagtgtgc |
29168129 |
T |
 |
| Q |
220 |
tgtgatgat |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
29168128 |
tgtgatgat |
29168120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 97 - 169
Target Start/End: Complemental strand, 29164368 - 29164293
Alignment:
| Q |
97 |
gcaatgatgaagatatctttgttgcttttc---ttaggcttcattgcaactatggttgatgctcgtttggatccaa |
169 |
Q |
| |
|
||||| |||||| ||||||| ||||||||| ||||| |||||||||| | | ||||||||| |||||||||||| |
|
|
| T |
29164368 |
gcaataatgaagttatctttcttgcttttcctcttaggtttcattgcaattgtagttgatgctggtttggatccaa |
29164293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University