View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4854_low_33 (Length: 224)
Name: NF4854_low_33
Description: NF4854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4854_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 213
Target Start/End: Complemental strand, 20898206 - 20897998
Alignment:
| Q |
5 |
cagagagacgcaaccctgccttctctatggaaggtgaagaacctcctgttgaagctgcaaaatctttcattgaatttgctttcataccagccctagtcaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20898206 |
cagagagacgcaaccctgccttctctatggaaggtgaagaaccttctgttgaagctgcaaaatttttcattgaatttgctttcataccagccctagtcaa |
20898107 |
T |
|
| Q |
105 |
aaagacaaaattttgagattttaagctaaaaatctttcagaatagcccgaacaagactagtaaacatttgtgctattattgttttattcaggattcgaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20898106 |
aaagacaaaattttgagattttaagctaaaaatctttcagaatagcccgaacaagactagtaaacatttgtgctattattgttttattcaggattcgaac |
20898007 |
T |
|
| Q |
205 |
acaggttct |
213 |
Q |
| |
|
| ||||||| |
|
|
| T |
20898006 |
ataggttct |
20897998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University