View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4855-Insertion-6 (Length: 145)
Name: NF4855-Insertion-6
Description: NF4855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4855-Insertion-6 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 5e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 7 - 145
Target Start/End: Original strand, 34864935 - 34865073
Alignment:
| Q |
7 |
acctaatgtgtttattggaggcaagcacattggtggttgtcactgtaaggctacacactcatgttgcttctttttcatgtggcaaagacaaaactagact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34864935 |
acctaatgtgtttattggaggcaagcacattggtggttgtgactgtaaggctacacactcatgttgcttctttttcacgtggcaaagacaaaactagact |
34865034 |
T |
|
| Q |
107 |
tgnnnnnnnnctttctgttttcattatttgtgtgtaata |
145 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |
|
|
| T |
34865035 |
tgttttttttctttctgttttcattatttgtgtgtaata |
34865073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 34869318 - 34869401
Alignment:
| Q |
7 |
acctaatgtgtttattggaggcaagcacattggtggttgtcactgtaaggctacacactcatgttgcttctttttcatgtggcaaa |
92 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| | |||||||| ||||||| | ||||| |||||||| | |||||| |
|
|
| T |
34869318 |
acctaacgtgtttattggaggcaagcacattggtggttgtgattgtaaggc--cacactccttttgctactttttcacgaggcaaa |
34869401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University