View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4856-Insertion-14 (Length: 261)
Name: NF4856-Insertion-14
Description: NF4856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4856-Insertion-14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 8 - 261
Target Start/End: Complemental strand, 34393136 - 34392883
Alignment:
| Q |
8 |
ttttccccacacactctccattctccccatagcataagtatgataagaaataaaccaacctttcataatcctagttccatctgggaagacatcgtcgttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
34393136 |
ttttccccacacactctccattctccccatagcataagtatgataagaaataaaccaacctttcataatcctagttccatctggtaagacatcgtcattt |
34393037 |
T |
 |
| Q |
108 |
aaacacgcttttgtatcaaccggcactggaggatacagtctcattgcctcggttatagctgcatgcaaataatgcatctccttcaactcttcatatccaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34393036 |
aaacacgcttttgtatcaaccggcaccggaggatacagtctcattgcctcggttatagctgcatgcaaataatgcatctccttcaactcttcatatccaa |
34392937 |
T |
 |
| Q |
208 |
acatcgtcgttgcacatccactctttaaacgtatcgtttcaatttcttcgatta |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34392936 |
acatcgtcgttgcacatccactctttaaacgtatagtttcaatttcttcgatta |
34392883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University