View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4856-Insertion-15 (Length: 265)
Name: NF4856-Insertion-15
Description: NF4856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4856-Insertion-15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 265
Target Start/End: Original strand, 51360781 - 51361037
Alignment:
| Q |
9 |
agcttgccatgtttgccacaaatcctatgttatcaagcaacatcattgctgcaatcgaaacataaatgaatttcggtttatttcaaaaacaaattaaagg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51360781 |
agcttgccatgtttgccacaaatcctatgttatcaagcaacatcattgctgcaatcgaaacataaatgaatttcggtttatttcaaaaacaaattaaagg |
51360880 |
T |
|
| Q |
109 |
aattgtggtgaacatatgtagtttacccaccaaagatgaaatgagtagctctatatcctccttgtttcggtttacttactgcttggtactcaacatcttt |
208 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51360881 |
aattgtgatgaacatatatagtttacccaccaaagatgaaatgagtagctctatatcctccttgtttcggtttacttactgcttggtactcaacatcttt |
51360980 |
T |
|
| Q |
209 |
gacattagtctcatcttttgaatcctgtattttaaaatcaacacattttaagcatat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51360981 |
aacattagtctcatcttttgaatcctgtattttaaaatcaacacattttaagcatat |
51361037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University