View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4856-Insertion-16 (Length: 145)
Name: NF4856-Insertion-16
Description: NF4856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4856-Insertion-16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 4 - 145
Target Start/End: Original strand, 46785603 - 46785744
Alignment:
| Q |
4 |
aacagtttttaacttgcttttattattgctgaaattaaacgcaaaacttacaaataagtaccactaataaatttgaatcgtcaaatctgaacacttttca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46785603 |
aacagtttttaacttgcttttattattgctgaaattaaacgcaaaacttacaaataagtaccactaataaatttgaatcgtcaaatctgaacacttttca |
46785702 |
T |
 |
| Q |
104 |
atagtcaacaacatgcactatggagaaagtggtgtttgggca |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
46785703 |
atagtcaacaacatgcactatggagatagtggtgtttaggca |
46785744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University