View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4856_low_7 (Length: 301)
Name: NF4856_low_7
Description: NF4856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4856_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 63 - 282
Target Start/End: Complemental strand, 7632050 - 7631836
Alignment:
| Q |
63 |
tcgaaagttgcacatgagcagaaggcaaggcaagtggataaaaacttgcataattaatctttttatttagcaaaatcaatcgtcttaaacacaacttcca |
162 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7632050 |
tcgaaagttgcacatgagcagaaggcaag-----tggataaaaacttgcataattagtctttttatttaacaaaatcaatcgtcttaaacacaacttcca |
7631956 |
T |
|
| Q |
163 |
atttccatagacctagaatttaatactttttagcaaaccgattcctcatcccaataacaaacctcatccttctatatatgcatgtaggacgcgtgatgtt |
262 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7631955 |
atttccatagacctagaatttaatactatttagcaaaccgattcctcatcccaataacaaacctcatccttctatatatgcatgtacgacgcgtgatgtt |
7631856 |
T |
|
| Q |
263 |
gcataactagtagcttttcg |
282 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7631855 |
gcataactagtagcttttcg |
7631836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 7633268 - 7633222
Alignment:
| Q |
1 |
aatttttcccccattaattttttcatcattaatttgaaataagaatg |
47 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7633268 |
aatttttccccaattaattttttcatcattaatttgaaataagaatg |
7633222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University