View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4857-Insertion-8 (Length: 172)
Name: NF4857-Insertion-8
Description: NF4857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4857-Insertion-8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 7e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 7e-66
Query Start/End: Original strand, 8 - 172
Target Start/End: Complemental strand, 10600787 - 10600630
Alignment:
| Q |
8 |
actgctgcattgggttccattgtcttggctgaacaaacacatttgggaaggtatacattgtttgattgattattactttatatacaccccttccattttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
10600787 |
actgctgcattgggttccattgtcttggctgagcaaacacatttgggaaggtatacattgtttgattggttattactttatatacacccc-------ttc |
10600695 |
T |
 |
| Q |
108 |
aattttcaatttggatgatcaaattacatgtccttattgtttgtgtcatacattagtagttgtta |
172 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10600694 |
aatttacaatttggatgatcaaattacatgtccttattgtttgtgtcatacattagtagttgtta |
10600630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University