View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4857_high_6 (Length: 302)
Name: NF4857_high_6
Description: NF4857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4857_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 21 - 292
Target Start/End: Original strand, 46807527 - 46807811
Alignment:
| Q |
21 |
agaagaatctctagttgcttcactcacatgcataaaatgataaaaattcaa-----------aactcacttttctgaaagaatgtccaggttcatcaaat |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46807527 |
agaagaatttctagttgcttcactcacatgcataaaatgataaaaattcaaccagtagcgaaaactcacttttctgaaagaatgtccaggttcatcaaat |
46807626 |
T |
 |
| Q |
110 |
taaaacaa--cttcacaaactcaaaagttcagtacacagatcatgatcgccgcatccatgtaaattcaaatggattggaccccaaattccatgcgttaaa |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46807627 |
taaaacaaaacttcacaaactcaaaagttcagtacacagatcatgatcgccgcatccatgtaaattcaaatggattggaccccaaattccatgcgttaaa |
46807726 |
T |
 |
| Q |
208 |
acacgtacgcacccaatgtgtcatccatgcagcccaaactgttcataacctaatgaaactagccaaattcctcaattttgttcat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46807727 |
acacgtacgcacccaatgtgtcatccatgcagcccaaactgttcataacctaatgaaactagccaaattcctcaattttgttcat |
46807811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University