View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4857_low_11 (Length: 244)
Name: NF4857_low_11
Description: NF4857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4857_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 14 - 219
Target Start/End: Complemental strand, 46836675 - 46836469
Alignment:
| Q |
14 |
aagcaaagggataaggtgtcggtgtaaaaacaaggatcatagggtaaaatgatgaacaatgagtactaaccaaaatgaattt-ccaaacatgtgatttca |
112 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46836675 |
aagctaagggataaggtgtcagtgtaaaaacaaggatcatagggtaaaatgatgaacaatgagtactaaccaaaatgaattttccaaacatgtgatttca |
46836576 |
T |
 |
| Q |
113 |
atggaagaagaaggtgaccttaaagcgttcaggttggaatacaaaaccgcgcttttggctttgtgatatctgttgagaacaccataacaaaactacaaat |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46836575 |
atggaagaagaaggtgaccttagagcgttcaggttggaatccaaaaccgcgcttttggctttgtgatatctgttgagaacaccataacaaagctacaaat |
46836476 |
T |
 |
| Q |
213 |
caggaca |
219 |
Q |
| |
|
||||||| |
|
|
| T |
46836475 |
caggaca |
46836469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University