View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4858_low_6 (Length: 240)
Name: NF4858_low_6
Description: NF4858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4858_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 72 - 119
Target Start/End: Complemental strand, 9359081 - 9359034
Alignment:
| Q |
72 |
aacaaataattattgagtaatttatatctgatattattacctatttga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9359081 |
aacaaataattattgagtaatttatatctgatattattatctatttga |
9359034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 35482891 - 35482931
Alignment:
| Q |
1 |
attcagaattagctaatagatagactgctgcaagaatcttc |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35482891 |
attcagaattagctaatagatagactgctgcaagaatcttc |
35482931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University