View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4859-Insertion-10 (Length: 141)
Name: NF4859-Insertion-10
Description: NF4859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4859-Insertion-10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 10 - 136
Target Start/End: Complemental strand, 31905870 - 31905744
Alignment:
| Q |
10 |
atgtgacatagtttattgatacggtcaaagttgcacaattaaaaatcgagagcaaaagcaaaattgcactttagcaaaaatagggtattcgctacacttt |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31905870 |
atgtgacatagtttattgataaggtcaaagttgcacaattaaaaatcgagagcaaaagcaaaattgcactttagcaaaaatagggtattcgctacacttt |
31905771 |
T |
|
| Q |
110 |
ttaaagtgtggagaagtggggaattca |
136 |
Q |
| |
|
|||||||| |||||||||||||||||| |
|
|
| T |
31905770 |
ttaaagtgcggagaagtggggaattca |
31905744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 133
Target Start/End: Complemental strand, 3313589 - 3313559
Alignment:
| Q |
103 |
acactttttaaagtgtggagaagtggggaat |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3313589 |
acactttttaaagtgtggagaagtggggaat |
3313559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 105 - 133
Target Start/End: Original strand, 21470374 - 21470402
Alignment:
| Q |
105 |
actttttaaagtgtggagaagtggggaat |
133 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21470374 |
actttttaaagtgtggagaagtggggaat |
21470402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 103 - 134
Target Start/End: Original strand, 32915561 - 32915592
Alignment:
| Q |
103 |
acactttttaaagtgtggagaagtggggaatt |
134 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
32915561 |
acactttttaaagtgtggagaagtagggaatt |
32915592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University