View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4859-Insertion-11 (Length: 317)
Name: NF4859-Insertion-11
Description: NF4859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4859-Insertion-11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] scaffold0171 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 8 - 317
Target Start/End: Original strand, 36734071 - 36734380
Alignment:
| Q |
8 |
cttttgaagttgtcgaataacgttatttcgaggatgattatgagccaaacttgtagtgaaaatgatggtgaagctgaagaggtgaggaagttggtgcaag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36734071 |
cttttgaagttgtcgaataacgttatttcaaggatgattatgagccaaacttgtagtgaaaatgatggtgaagctgaagaggtgaggaagttggtgcaag |
36734170 |
T |
|
| Q |
108 |
acactgtacatcttacggggaagtttaatatttctgattttatttggttttttaagaactgggatgtccaggggtttagcaaagggttaaaggaaattag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36734171 |
acactgtacatcttacggggaagtttaatatttctgattttatttggttttttaagaactgggatgtccaggggtttagcaaagggttagaggaaattag |
36734270 |
T |
|
| Q |
208 |
ggacaggtttgattctatgatggagaggattatcaaggagcatcaagaagtaaggaggaggagaaaggaagttggtggaggagaaggtcaaattaaggat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36734271 |
ggacaggtttgattctatgatggagaggattatcaaggagcatcaagaagtaaggaggaggagaaaagaagttggtggaggagaaggtcaaattaaggat |
36734370 |
T |
|
| Q |
308 |
ctacttgata |
317 |
Q |
| |
|
|||||||||| |
|
|
| T |
36734371 |
ctacttgata |
36734380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 92 - 172
Target Start/End: Original strand, 18973 - 19053
Alignment:
| Q |
92 |
aggaagttggtgcaagacactgtacatcttacggggaagtttaatatttctgattttatttggttttttaagaactgggat |
172 |
Q |
| |
|
|||||| |||||||||| | |||| | ||| | |||| ||||||| | || ||||||||||||||||||||||| |||||| |
|
|
| T |
18973 |
aggaagatggtgcaagatagtgtagagctttcagggaggtttaatttgtcggattttatttggttttttaagaattgggat |
19053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University