View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4859-Insertion-7 (Length: 255)
Name: NF4859-Insertion-7
Description: NF4859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4859-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 255
Target Start/End: Complemental strand, 20093972 - 20093725
Alignment:
| Q |
7 |
attaggtgcttgtaatctttgttattacactacttggcataagtgtgatataaataattcttacgtttaccataagcaaggttgaatgttgattcataat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20093972 |
attaggtgcttgtaatctttgttattacactacttggcataattgtgatataaataattcttacgtttaccataagcaaggttcaatgttgattcataat |
20093873 |
T |
|
| Q |
107 |
gaggaagctagaacatgccccacgagcaaagcaaattaattaactttacggggtccatgatccaaacattatgccctcatacaatacaattgtactacaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
20093872 |
gaggaagctagaacatgccccacgagcaaagcaaattaattaactttacagggtccatgatccaaacaacatgccctcatacaatacaattgtactac-a |
20093774 |
T |
|
| Q |
207 |
tctcatcaactagtgaaagtaacgatgcccctccttgtgcgctggctgt |
255 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
20093773 |
tctcatcaactagtgaaagtaatgatgtccctccttgtgcgctggctgt |
20093725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University