View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4859-Insertion-9 (Length: 136)

Name: NF4859-Insertion-9
Description: NF4859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4859-Insertion-9
NF4859-Insertion-9
[»] chr2 (1 HSPs)
chr2 (7-115)||(13394350-13394457)


Alignment Details
Target: chr2 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 7 - 115
Target Start/End: Original strand, 13394350 - 13394457
Alignment:
7 aacaatctaaaagaaataaaagcgattaaatattatgtgtgtgttgaagtcgtgttaatcgtgtcagacattagatacactttcaatcgatgctacgtag 106  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
13394350 aacaatctaaaagaaataaaagcgattaaatattacgtgtgtgttgaagtcgtgttaatcgtgtcagacattag-tacactttcaatcgatgctacgtag 13394448  T
107 aatttaaca 115  Q
    |||||||||    
13394449 aatttaaca 13394457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University