View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4859-Insertion-9 (Length: 136)
Name: NF4859-Insertion-9
Description: NF4859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4859-Insertion-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 7 - 115
Target Start/End: Original strand, 13394350 - 13394457
Alignment:
| Q |
7 |
aacaatctaaaagaaataaaagcgattaaatattatgtgtgtgttgaagtcgtgttaatcgtgtcagacattagatacactttcaatcgatgctacgtag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13394350 |
aacaatctaaaagaaataaaagcgattaaatattacgtgtgtgttgaagtcgtgttaatcgtgtcagacattag-tacactttcaatcgatgctacgtag |
13394448 |
T |
 |
| Q |
107 |
aatttaaca |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
13394449 |
aatttaaca |
13394457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University