View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4861-Insertion-9 (Length: 147)
Name: NF4861-Insertion-9
Description: NF4861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4861-Insertion-9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 7 - 147
Target Start/End: Original strand, 4324775 - 4324915
Alignment:
| Q |
7 |
attaacaaagaatcccttttagcatctgcaaaaaatggtttggctgtaaagattcttagcaagggaaaagaggtgcctgatgaacctgtaattgacaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4324775 |
attaacaaagaatcccttttagcatctgcaaaaaatggtttggctgtaaagattcttagcaagggaaaagaggtgcctgatgaacctgtaattgacaaca |
4324874 |
T |
 |
| Q |
107 |
aaagaaacctgcaaaaaggttagggctcgtttaatgattga |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4324875 |
aaagaaacctgcaaaaaggttagggctcgtttagtgattga |
4324915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University