View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4861_high_4 (Length: 250)
Name: NF4861_high_4
Description: NF4861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4861_high_4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 25414275 - 25414039
Alignment:
| Q |
13 |
aatattatgcaatcacagatttgtcggatttcaaccattgaatgaaattctggctcctacagaatctattcatgttatagggtttagggtttagggtatt |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25414275 |
aatattattcaatcacagatttgtcggatttcaaccattgaatgaaattctggctgctacataatctatt-atgttatagggtttagggtttagggtatt |
25414177 |
T |
|
| Q |
113 |
gtaaactaagtagctattattatagaagatgcatttttgccataagaaaattattacaacactgataatattaacttactcagggaatgcaaaagaacct |
212 |
Q |
| |
|
|| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25414176 |
gttaactaagttgctattattattatagatgcatttttgccataagaaaattattacaacactgataatattaacttactcagggaatgcaaaagaacct |
25414077 |
T |
|
| Q |
213 |
ctactgccttcagattgattagagttccttgaattatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25414076 |
ctactgccttcagattgattagagttccttgaattatt |
25414039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University