View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4861_low_4 (Length: 293)
Name: NF4861_low_4
Description: NF4861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4861_low_4 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 154 - 293
Target Start/End: Complemental strand, 10983075 - 10982936
Alignment:
| Q |
154 |
cataaagaaatagtatcgctgagcacttttaaaataatttgtgtagaaaaggataattgtgcaaatatttatgaattaaaccacctatttattacaaaaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10983075 |
cataaagaaatagtatcgctgagcacttttaaaataatttgtatggaaaaggataattgtgcaaatatttatgaattaaaccacctatttattacaaaaa |
10982976 |
T |
 |
| Q |
254 |
caaataaattaaaggagcccaatttatccgaatcacaatt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10982975 |
caaataaattaaaggagcccaatttatccgaatcacaatt |
10982936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University