View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4861_low_8 (Length: 227)
Name: NF4861_low_8
Description: NF4861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4861_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 25 - 227
Target Start/End: Original strand, 29089220 - 29089426
Alignment:
| Q |
25 |
atcttatcttatataagtaaatggagtattagaagtgatgtgaatttgtgaaatgtattattccctctcaaatggtggggcctcggctgaaacaagcata |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29089220 |
atcttatcttatataagtaaatggagtattagaagtgatgtgaatttgtgaaatgtaatattccctctcaaatggtgggacctcggctgaaacaagcata |
29089319 |
T |
|
| Q |
125 |
gcggtagaggagcaaattctttcaatgttagccaatatggctaagcaaaagttgaagcaaaataa---agaaact-atatgccacaaaagatcaaatgtc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
29089320 |
gcggtagaggagcaaattctttcaatgttagccaatatggctaagcaaaagttgaagcaaaataaaagaaaaactaatatgccacaaaagatcaaatgtc |
29089419 |
T |
|
| Q |
221 |
attttct |
227 |
Q |
| |
|
||||||| |
|
|
| T |
29089420 |
attttct |
29089426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University